Introduction

Telipogon Kunth is a diverse Neotropical orchid genus encompassing approximately 240 species that range from Mexico, Antilles, Central America, and the Andes, from Venezuela to Bolivia. The genus is particularly diverse in Colombia, Ecuador, and Peru (Bogarín 2012, Chase 2009, Dodson 2004, Martel et al. 2020). Plants of Telipogon are found exclusively in montane and submontane forests at 500 to 3600 meters of elevation (Chase 2009, Collantes & Martel 2015), and endemic species with very restricted distributions are frequent (Endara 2011, Martel 2020).

Telipogon species are characterized by very small-to medium-sized plants (2-25 cm), with a caespitose, sympodial, epiphytic, or rarely terrestrial habit; the stems are either abbreviated or elongated with conduplicate leaves; the flowers vary from very small to large and born from racemes or panicles; the corolla is usually yellow with dark red tones, and regularly striped; the petals are usually similar to the lip in shape, color, and size; the lip often bears a basal, hirsute callus, enclosing a short, brown to purple column; the column is semiterete and usually bears tufts of setae. This unique feature inspired the genus name Telipogon, derived from the Greek words “telos” meaning “end or point,” and “pogon” meaning “beard”. Additionally, the pollinarium bears an uncinate sticky viscidium and 2 irregularly-sized pairs of pollinia (Chase 2009, Dodson 2004, Martel et al. 2020). Diagnostic characteristics used to discriminate among species are plant and flower size, stem and peduncle length and shape, shape and color of petals, lip (including pattern and color of veins) and lip callus (if present), and the shape of the column (including appendages and setae type, number,andarrangement)(e.g., Dodson & Escobar 1993, Nauray & Galán 2008).

Various classifications of Telipogon and its relatives have been proposed throughout the last century. Schlechter (1915) established Stellilabium Schltr. based on Telipogon astroglossus Rchb.f. and the same author created the subtribe Telipogoninae to include Stellilabium, Telipogon, and Trichoceros Kunth (Schlechter 1915). Later, Dressler and Dodson (1960) placed these genera, together with Hofmeisterella, in the Ornithocephalus Alliance. However, Dressler (1993) later placed those genera within their own subtribe Telipogoninae. Nevertheless, genetic evidence showed that Telipogon and its allies were embedded within the Oncidiinae, and Stellilabium was also embedded in Telipogon (Williams et al. 2005). Consequently, all former Stellilabium species were reclassified under Telipogon, and the Telipogoninae subtribe was treated under Oncidiinae, forming the Telipogon alliance (Martel et al. 2020, Williams et al. 2005). This alliance is monophyletic and comprises Hofmeisterella as the sister group to the Trichoceros-Telipogon clade (Amezcua-Trigos et al. 2018, Chase 2009, Neubig et al. 2012, Williams et al. 2001, Williams et al. 2005). Concerning Telipogon’s infrageneric relationships, published phylogenies suggest phylogenetic clades that correspond to geographic distribution, distinguishing, for example, a clade comprising Andean Telipogon species with large flowers and another clade including Central American Telipogon species, along with some former Stellilabium species from Central America, Andean Telipogon species with elongated stems, and Andean species from the former Stellilabium (Neubig et al. 2012, Williams et al. 2005). However, these phylogenies have primarily focused on Central American Telipogon species, with only a limited representation of South American species. Consequently, the infrageneric relationships within Telipogon remain incompletely understood.

The Ecuadorian Andes is one of the centers of Telipogon diversity. Nevertheless, although much remains to be explored in this region. For instance, the Parque Nacional Llanganates (PNL), located in the Cordillera de Los Llanganates in the Ecuadorian east-central Andes, is known for its rich biodiversity, high levels of plant endemism, and historical significance, as it was believed to conceal the treasure of Atahualpa, the last Inca emperor (Andrade Marín 1970, Spruce 1908, Vargas et al. 2000). The buffer zone of the PNL, situated in the upper watershed of the Pastaza River, has served as a key area for biological research in Ecuador, leading to the description of numerous species (Jost 2004, Reyes-Puig et al. 2010, 2022, Yánez-Muñoz et al. 2010). Therefore, it is considered an important center for plant endemism within the eastern range of the Ecuadorian Andes (Jost 2004).

During a botanical expedition to the PNL, an undescribed species of large-flowered Telipogon was discovered near the buffer zone of the park. Here, we describe, illustrate, and compare this new species with other morphologically similar species. Furthermore, we provide genetic evidence to elucidate its phylogenetic relationships. Additionally, we include information about the geographical distribution and conservation status of this newly discovered entity.

Materials and methods

Species information.- Some specimens were collected for ex-situ cultivation, awaiting additional blooming, while other specimens were directly pressed as voucher material. Vegetative parts were dried, and flowers were preserved in a solution containing 70% ethanol, 29% water, and 1% glycerol.

Voucher specimens were deposited in the herbarium of the Museo Ecuatoriano de Ciencias Naturales (QCNE) in Quito, Ecuador. Photographs of floral and vegetative structures were taken using a Nikon D5100 camera with an AF-S DX Micro Nikkor 40mm f/2.8G lens and a Canon EOS T6 camera with a Canon EF-S 35/28 Macro lens.

Telipogon in Ecuador has not been revised, and infrageneric classifications (Brass 1981, Kränzlin 1919) are deficient. Therefore, comparisons are limited to morphologically similar species (see Table 1). Protologues, illustrations and all the available holotype herbarium specimens of similar species were analyzed to compare with the new species. Figures and a composite digital line drawing were prepared using Adobe Photoshop® 2019. Additional pictures and information on the local distribution of the species were provided by Juan Medina, a local tour guide, who has also observed the species for several years.

The conservation status evaluation, the extent of occurrence (EOO), and the area of occupancy (AOO) analysis for this species were developed using the GeoCAT tool and the IUCN criteria (Bachman et al. 2011, IUCN 2022). The distribution, extent of occurrence and the area of occupancy map of the new taxon were prepared using ArcGIS (GIS software version 10.8: Redlands, CA: Environmental Systems Research Institute, Inc. https://www.esri.com/).

Phylogenetic analysis.- Fresh leaves of several Ecuadorian Telipogon species were collected in the field (Table 2), dried in silica gel, and transported to the research laboratories at Universidad de Las Américas (UDLA). Genomic DNA was isolated from the leaves using a rapid extraction procedure (Kasajima et al. 2004).

Two regions of the extracted DNA, nuclear ribosomal internal transcribed spacer (rITS) and plastid Maturase K (matK), were amplified by the Polymerase Chain Reaction (PCR) technique. The PCR reaction consisted of 7.5 μL GoTaq Green Master Mix 2X (Promega), 3 μL of extracted DNA, 7.5 μL ultrapure water, and 0.75 μM of each primer. Primers for rITS: ITS1: TCCGTAGGTGAACCTGCGG (Vijayan & Tsou 2010); ITS4: TCCTCCGCTTATTGATATGC (Vijayan & Tsou 2010). Primers for matK: matK-56F: ACTTCCTCTATCCGCTACTCCTT (Williams et al. 2005); matK-2.1a-Fw: ATCCATCTGGAAATCTTAGTTC (Vijayan & Tsou 2010); matK-2.1a-Fw: GTTCTAGCACAAGAAAGTCG (Vijayan & Tsou 2010). PCR conditions: 95 °C - 2 min, 95 °C - 1 min, 55 °C - 1 min, 72 °C - 1 min, 35 cycles, and final extension of 72 °C - 15 min. PCR products were purified, and Sanger sequenced (ABI 3500xL Genetic Analyzer, Applied Biosystem).

For the phylogenetic reconstruction, additional nucleotide sequences of the available South American Telipogon species, some Central American species, and closely related orchid genera were obtained from NCBI https://www.ncbi.nlm.nih.gov/ (Table 2). Further, we generated sequencing data of another five available Ecuadorian Telipogon species were deposited in GenBank (see Table 2). In total, the analyses included 20 species of Telipogon, one Hofmeisterella Rchb.f., and one Trichoceros Kunth, all belonging to the Telipogon alliance (Williams et al. 2005, Martel et al. 2020), were included. Fernandezia sanguinea (Lindl.) Garay & Dunst. was used as the outgroup.

The software Geneious Prime 2022.1 (https://www.geneious.com/) was used for the concatenating and editing of the sequences. Sequence alignment was performed using the MUSCLE tool (Edgar 2022). A Bayesian Inference (BI) and a Maximum Likelihood (ML) were conducted with the aligned sequences. For BI, we used BEAST v.1.10.4 (Suchard et al. 2018). MCMC analysis was conducted using a GTR substitution model, a Yule speciation model, and a relaxed log-normal clock and run for 10 million generations with tree sampling at every 10,000 generations. Then, we used LogCombiner v.1.10.4 (http://beast.community/logcombiner) to combine resulting trees with a burnin of 25% and then TreeAnnotator v.1.10.4 (http://beast.community/treeannotator) to generate a single maximum clade credibility tree. Geneious Prime was used to visualize the resultant tree. For ML, we used the PhyML plugin (Guindon et al. 2010) in Geneious Prime, under the GTR+G model and 1000 bootstrap replicates. The best substitution model was estimated with the software Mega 11.0.13 (Tamura et al. 2021).

Taxonomic treatment

Telipogon pillaropatatensis Iturralde, Monteros & Baquero, sp. nov.Fig. 1-2.

TYPE: Ecuador. Tungurahua: Above Baquerizo Moreno (coordinates omitted for conservation reasons; detailed data on the herbarium Type specimen), 11 January 2022, Gabriel A. Iturralde, GI-2210-5890 (holotype, QCNE!).

Diagnosis: Telipogon pillaropatatensis is morphologically similar to T. octavioi Dodson & R.Escobar as they share the yellow, brown-toned flowers, a mostly free, dark callus of the lip, and a setose column. However, T. pillaropatatensis is distinguished by the petals and lip with longitudinal vein-lines without reticulations (vs. reticulated lines), the column setae are similarly sized (vs. the column setae from the lateral tufts are longer than those from the dorsal tuft), the three dense tufts of bristles, appearing to be a single large tuft reaching the front and obstructing the view of the anther (vs. three less dense, well-differentiated tufts leaving the anther visible).

Plant epiphytic, caespitose, up to 20 cm in length, including inflorescence. Roots 1.0-1.5 mm in diameter, thick, cylindrical. Stem abbreviated, up to 1 cm long, laterally compressed, covered by 1-4 distichous, imbricating bracts. Leaves 4-8 cm long, 2-4 per stem, sub-coriaceous, distichous, articulated, decurrent, blade 4.0-7.5 × 0.9-1.7 cm, elliptic to very deeply obovate, acute, conduplicate, carinate abaxially, the basal leaves shorter than the upper leaves. Inflorescence apical, erect, racemose, 1-5 simultaneously flowered, opening in succession; peduncle 4-16 cm, compressed, ancipitous at the base and gradually widening towards the apex becoming tetragon; rachis ancipitous; floral bracts translucent, yellow-green, 1.0 × 0.9 mm, conduplicate, triangular-ovate, acute, carinate abaxially. Ovary 23-34 mm long, pedicellate, triquetrous. Flowers 30-42 × 29-35 mm, non-resupinate. Sepals 15-18 × 8-9 mm, concave, ovate, acute, light yellow, sometimes with 1-2 red longitudinal stripes, carinate abaxially, 3-veined. Petals 15-21 × 14-21 mm, sub-orbicular, sub-rhombic or broadly ovate, 10-13-veined, slightly concave in the center and the apical edge slightly reflex, copper to golden yellow heavily suffused with dark brown stains and dots towards the apical half with thick, sometimes doubled towards apical half, dark red-brown veins, and with very few reticulation-lines between the veins only at the base, the edge papillate, the base obtuse, fleshy and ciliolate, glabrous, shining under direct light, the apex right to acute, shortly apiculate. Lip 15-20 × 19-26 mm, broadly ovate, concave, coloration and vein pattern similar to those of the petals, but without reticulations at the base, 17-23-veined, ciliolate margins; the apex rounded, shortly apiculate; callus adnate to the base of the lip, 4.5-6.0 × 5.5-6.0 mm, broad, cordiform, sub-trilobed, pubescent, papillose, dark purple, swollen in the longitudinal center towards the apex, mammate apex, raised 2 mm free from the lip, curved downwards. Column 4 × 3 mm, subterete, sessile, minutely papillose, dark purple, with three dense tufts of setae of equal size around the anther (one dorsal and two lateral); setae acicular, purple with a white tip, simple, up to 3.0 mm long. Stigma sub-trapezoid, dark purple, with thickened and slightly sinuate margins, the margin opposed to the rostellum protruding 0.5 mm. Anther 2.0 × 2.6 mm, dorsal, cordiform, red-brown. Pollinarium 4 mm long, with two pairs of unequal pollinia; stipe 2.2 mm long; viscidium uncinate. Capsule 3-winged (only immature capsules observed).

Additional specimens examined (paratypes): Ecuador. Tungurahua: Above Patate (coordinates omitted for conservation reasons; detailed data on the herbarium specimen), 11 July 2022, Marco F. Monteros, MFM 239 (QCNE!).

Other telipogon species examined: Telipogon octavioi: COLOMBIA: Putumayo: paso entre la Laguna de La Cocha y Sibundoy, km 31, 3150 m, 24 Jan 1987, Dodson et al. 17018 (MO - Holotype). ECUADOR: Sucumbíos: El Mirador, Playón de San Francisco - Julio Andrade Km 12, 3200-3400 m, Dodson, Williams & Whitten 18786 (MO).

Phylogenetic analyses: The phylogenetic trees constructed from the concatenated markers rITS and matK showed high correspondence (Fig. 3). The new entity is genetically distinct from all the analyzed species. Despite being morphologically similar to T. octavioi, T. pillaropatatensis seems not closely related; furthermore, the new species might be more related to the clearly morphologically distinct T. pulcher Rchb.f., T. hausmannianus Rchb.f. and T. andicola Rchb.f. (Fig. 3).

Etymology: This species is named in honor of the cantons of Píllaro and Patate, in the province of Tungurahua, so that its inhabitants feel inspired and proud to protect the last remnants of nearby high Andean Forest where this beautiful species lives.

Phenology and flower variations: Plants of T. pillaropatatensis have been observed with flowers and floral buds between July and October. During the visits in February and March, all plants exhibited only vegetative parts and fruits except one plant with withered flowers. Considering all this, its blooming period might extend from June to December.

A considerable difference in the brightness of the flowers has been observed between plants that grow in the understory (those not directly exposed to sunlight) and those growing under direct sunlight (those growing on the edges of the forest or next to trails). The dark brown stains and spots of the corolla, as well as the intensity of vein marks (especially on the petals) are almost absent in plants growing in the understory. In contrast, plants growing under full sunlight display very pronounced dark stains and vein marks. This color variation is limited to the petals and lip, with no noticeable differences observed in the column and callus, which remained consistent regardless of sunlight intensity (Fig. 4-5). This phenomenon was further confirmed when plants grown ex-situ under indirect sunlight also produced pale flowers with a weak dark coloration (see Fig. 4B). Therefore, direct sunlight might be critical in inducing the production of the pigments responsible for the dark brown coloration of the petals and lip in this species.

An exceptional individual with xanthic flowers was also recorded in the wild (see Fig. 5D). This flower lacked any dark pigments on the petals and sepals, and its column and callus had a bright yellowish-orange coloration. This individual’s lack of dark pigments might be linked to genetic constraints, not environmental conditions associated with sunlight intensity.

Flowers of T. pillaropatatensis varied in size. Young plants, characterized by having one inflorescence and one flower, had smaller flowers compared to mature developed plants bearing two inflorescences and several flowers. A range of color variations and sizes in the flower perianth of T. pillaropatatensis is depicted in Fig. 4. Floral variation, particularly in the perianth, has also been observed in other Telipogon species (e.g., T. vollesii Dodson & R.Escobar, T. semipictus Rchb.f. ex Kraenzl., T. thomasii Dodson & R.Escobar), although not with such pronounced color variability.

Distribution, habitat, and ecology: Plants of T. pillaropatatensis have been found above 3000 m in the forest remnants of a small mountain range in the surroundings of Píllaro and Patate, located in the Tungurahua province, southwest of the Cordillera de Los Llanganates (Fig. 6). This area represents the westernmost portion of the upper zone of the Pastaza basin, an important center of plant and animal endemism in the eastern range of the Ecuadorian Andes. Plants of T. pillaropatatensis inhabit the evergreen high montane forest ecosystem (Ministerio del Ambiente del Ecuador 2013). Despite intensive explorations, this species has not been found on the eastern slope of the same mountain range, suggesting a restricted distribution facing the Inter-Andean Valley. Plants of the new species grow sympatrically with T. hausmannianus Rchb.f. and other orchids such as Lepanthes monoptera Lindl., L. mucronata Lindl., Odontoglossum pardinum (Lindl.) Lindl., Oncidium cultratum Lindl., Pleurothallis llanganatensis (Luer & Hirtz) J.M.H.Shaw, and Stellis pusilla Kunth.

Conservation status: Plants of Telipogon pillaropatatensis grow in montane forests surrounded by farms and pastures for agriculture and livestock. Intense agricultural activities and cattle raising are rapidly and gradually destroying the last natural patches, since farmers cut down the native forest to establish potato and corn crops or new pastures for livestock. Unfortunately, there is minimal to no effort made to restore the impacted regions (Fig. 5E). The extent of occurrence (EOO) calculated for T. pillaropatatensis resulted in an area of 26.8 km², and an area of occupancy (AOO) of 16 km² (Fig. 6B). Considering the potential loss of habitat by human activities and an AOO < 20 km² we recommend classifying T. pillaropatatensis as Endangered (EN) according to the criteria B2 (IUCN 2022).

Discussion

Like most Ecuadorian Telipogon species, T. pillaropatatensis shows a sympodial growth with short, flattened stems, ancipitous-at-the-base inflorescences, and a triquetrous ovary. When exposed to sunlight, the corolla of T. pillaropatatensis flowers produces a silvery reflection. This optical effect is attributed to the papillate epidermis (Fig. 4C), which might also occur in other Telipogon species. Telipogon pillaropatatensis is morphologically similar to T. octavioi (Dodson & Escobar 1993). Both species share common characteristics such as the yellow suffused with brown petals and lip, markedly brown veins, the free, dark, cordiform, hirsute callus, and the setose column. Nevertheless, T. pillaropatatensis can be distinguished from T. octavioi by the thick, longitudinal, sometimes doubled vein-lines without reticulations except at the petal base (vs. thick veins with reticulations along the corolla in T. octavioi), the minutely papillose column ventrally and at the sides (vs. glabrous in T. octavioi), the similar sized setae arranged in an apparent single tuft (vs. three tufts of differentiated setae, lateral ones longer than those of the dorsal bundle in T. octavioi), and the denser tufts of setae that reach the front and obstructs the view of the anther (vs. less dense tufts allowing view of the anther in T. octavioi). Other species from Ecuador with similar perianth coloration and a thick sagittate or cordiform callus include T. isabelae Dodson & Hirtz, T. thomasii, T. elizabethiae Iturralde, Baquero & C.Martel, and T. crisariasiae Baquero & Iturralde (see Fig. 7; for detailed descriptions see Baquero et al. 2022, Dodson 2004, Iturralde et al. 2021, Dodson & Dodson 1989). Nevertheless, there are distinct differences in the apex of the callus lobes among these species. In T. thomasii, the apex is ovate, while in T. crisariasae it is truncate. In contrast, in T. pillaropatatensis the apex is broadly subfalcate. Furthermore, the callus shape varies, with T. pillaropatatensis having a cordiform callus, T. isabelae with a broadly cordiform callus, and T. elizabethiae displaying a sagittate callus. A detailed morphological comparison of the floral pieces of each species is shown in Table 1.

The topology of the phylogenetic trees constructed using Bayesian Inference (BI) and Maximum Likelihood (ML) analyzes was almost identical. The correspondence obtained, regardless of the statistical approach used, supports the results presented here.

Additionally, the reconstructed phylogenetic trees are coherent with the tree topologies obtained in previous studies (Martel et al. 2020, Neubig et al. 2012, Williams et al. 2005). In these studies, two clades of South American Telipogon were identified: 1) the former Central and South American Stellilabium together with the caulescent T. nervosus (L.) Druce group, and 2) the other big flowered South American Telipogon species. Our results indicate that T. pillaropatatensis belongs to the second clade and show a closer phylogenetic relationship with T. pulcher, T. hausmannianus and T. andicola Rchb.f. than to the morphologically similar T. octavioi (Fig. 3). It is worth noting that the results presented here are insufficient to further infer the phylogenetic relationships of the Ecuadorian Telipogon species. However, our results support the proposal of T. pillaropatatensis as a new species.

Acknowledgments

The authors thank Lou Jost for his critical review of a previous draft of this manuscript. We thank Juan Miguel Iturralde for his assistance during the field exploration. We also thank Juan Medina, a local tour guide and orchid enthusiast who provided important information on the occurrence, ecology, and potential factors that can affect the conservation of the new species. We thank Yanua Ledesma, Salomé Guerrero, Vinicio Armijos and Byron Freire for their help with the molecular analysis. We thank Universidad de Las Américas (UDLA) for funding orchid research in Ecuador, grant No. AGR.GID.22.01. The Ministerio del Ambiente del Ecuador is acknowledged for issuing the Environmental Contract for access to genetic resources No. MAATE-DBI-CM-2021-0187. C.M. is supported by a research grant from the Programa Nacional de Investigación Científica y Estudios Avanzados - Prociencia (Convenio Nº 126-2020-Prociencia) and The Max Planck Partner Group. The anonymous reviewers are thanked for their valuable comments to improve the manuscript.

Literature cited

Publication Dates

History